Protocols

Protocols for the identification and isolation of ambrosia fungi

1. Obtaining ambrosia fungi DNA from a whole beetle specimen

Ambrosia fungi can be identified from any ambrosia beetle specimen, even if it is preserved in ethanol, as long as there are adequate spores in the mycangium. One effective method is as follows:

1. Grind the whole beetle specimen using a tissue grinder or micro pestle in 50µl of PrepMan® Ultra Sample Preparation Reagent (Applied Biosystems, Foster City CA) or other extraction buffer of choice. Alternatively, dissect the beetle with fine forceps under a stereo microscope to remove the mycangium or the part of the beetle containing the mycangium, squish with forceps, and add to 50µl of PrepMan® Ultra Sample Preparation Reagent.

2. Perform the extraction protocol as written for the chosen extraction buffer.

3. Centrifuge the extraction mixture and transfer the supernatant to a new DNase-free microtube. This aliquot is ready to be used as PCR template.

4. DNA extracts from whole beetles or from mycangia often need to be concentrated before successful amplification.

2. Amplifying and sequencing ambrosia fungi barcode sequences

The best way to positively identify an ambrosia fungus species is to obtain a barcode sequence. We have found the ITS (Internal Transcribed Spacer) region to be appropriately diagnostic for ambrosia fungi in the Ceratocystidaceae and the LSU (Large Ribosomal Subunit) region to be appropriate for Raffaelea spp.; ITS amplification is difficult to impossible in most Raffaelea spp.

2.1 ITS Amplification and sequencing for the identification of Ambrosiella, Meredithiella, Phialophoropsis, and other Ceratocystidaceae species

ITS amplification using the general fungal primers ITS1F and ITS4 (see Vilgalys lab, Duke) is appropriate for DNA from pure cultures. For amplifying ITS sequences from mixed culture, galleries, or directly from beetles, we developed the Ceratocystidacae-specific primer pairs Cerato-1F/ITScer3.7R for ITS1 and ITSCer3.1/ITS4 for ITS2.

Cerato-1F (5' - GCGGAGGGATCATTACTGAG - 3')
ITSCer3.7R (5' - GTGAAATGACGCTCGGACAG - 3')
ITSCer3.1 (5' - CAACGGATCTCTTGGCTCTA - 3')

ITS amplification with both general and specific primer sets is best done with the thermocycler program BSR-ITS.

BSR-ITS
85° C for 2 minutes
95° C for 1 minute 35 seconds
36 cycles of the following three steps:
    58° C for 1 minute
    72° C for 1 minute 20 seconds
    95° C for 1 minute 10 seconds
52° C for 1 minute
72° C for 15 minutes

2.2 LSU Amplification and sequencing for the identification of Raffaelea and other Ophiostomatales species

LSU amplification using the general primers LROR and LR5 (see Vilgalys lab, Duke) is appropriate for amplification using the same BSR-ITS program described above. Sequencing is best done with LROR and LR3.

3. Identifying an ambrosia fungi by ITS or LSU sequence

DNA sequences should be trimmed before performing a BLAST search. For ITS sequences, remove all nucleotides prior to the sequence "TCATTA" near the beginning and all nucleotides after "GGTT" near the end. See ITS sequences in the database file below for examples to use as reference with your own sequences.

BLAST searches can be performed at NCBI BLASTn against our ITS or LSU datasets by using them as a custom subject set. Follow the link to NCBI BLASTn and click the check box next to "align two or more sequences." Then, for the Subject Sequence, click "Choose File" and upload one of the fasta format files provided in the compressed zip file below:

Ceratocystidaceae ITS database: Ceratocystidaceae_database_092515.zip

Ophiostomatales LSU database: Under construction

Further information about the species matches in the database can be found in the species index. Results should be analyzed carefully. Even 99% matches or results differing by a single base can be different species.

4. Isolating live ambrosia fungus cultures from a beetle specimen

The beetle must be alive or recently killed and kept moist; the spores are extremely susceptible to desiccation and any drying will reduce or eliminate the recovery of live cultures. This method is also ineffective for specimens preserved in ethanol.

4.1 Grind and spread method

1. The beetle should be surface-sterilized first to remove external superficial contaminants. A good method is to wholly immerse the beetle in 75% ethanol for 10 seconds, then transfer to two successive washes of sterile dH2O and dry on sterile absorbent paper. This does not typically kill the beetle and is effective at killing superficial spores such as Ophiostoma, Leptographium, Fusarium, and some Raffaelea spp.

2. Place the beetle in a glass tissue grinder with 200µl sterile dH2O and grind for X minutes.

3. Add an additional 800µl sterile dH2O to the tissue grinder and grind further until homogeneous.

4. Pipette transfer 1ml of beetle grindate from the tissue grinder to a sterile microfuge tube (the 1X dilution.)

5. Dilute the grindate further as needed (typically 10X and 100X are useful dilutions.)

6. Transfer 100µl to agar media (recommended to use SMA for Ceratocystidaceae and CSMA for Raffaelea) and spread with sterile glass spreader sticks to obtain tenfold effective dilutions (ex. 10X from 1X dilution, 100X from 10X dilution, and 1000X from 100X dilution.)

7. Characterize, subculture, and count the resulting colonies, which can be used to estimate the CFUs (colony forming units) per mL in the original grindate and therefore the approximate amount of spores present inside the beetle.

note: Many ambrosia fungi take a significant amount of time (several weeks) to germinate on both SMA and CSMA, especially Phialophoropsis spp. Special care is required to isolate and count these fungi from gut/internal yeast and bacteria.

4.2 Direct transfer

1. The beetle should be surface-sterilized as described in 4.1 above.

2. A sterile needle can be inserted into the area of the mycangium and the spores transferred to agar media; or the beetle specimen can be crushed and the carcass transferred to agar media; or the beetle specimen can be dissected and sectioned out, and the parts transferred to agar media, with special attention paid to the areas containing the mycangium.

Appendices

i. Agar media used in the isolation, upkeep, and study of ambrosia fungi

The following media recipes are useful in the isolation and culturing of ambrosia fungi.

i.i. Media for isolation

SMA - Streptomycin malt extract agar
Useful for isolating ambrosia fungi from galleries or beetles; reduces bacterial contamination

100 Mg streptomycin sulfate
10g malt extract (Difco)
15-20g agar (x)
1L sterile dH2O

CSMA - Cyclohexamide/streptomycin malt extract agar
Selective for Raffaelea spp. and other fungi resistant to Cyclohexamide.

200 Mg cyclohexamide
100 Mg streptomycin sulfate
10g malt extract (Difco)
15-20g agar (x)
1L sterile dH2O

i.ii. Media for culture upkeep and characterization

MEA - Malt extract agar

15g malt extract (Difco)
15-20g agar (x)
1L sterile dH2O

MYEA - Malt/yeast extract agar

20g malt extract (Difco)
2g yeast extract (Difco)
15-20g agar (x)
1L sterile dH2O

i.iii. Media for special use and study

SAB - Sabaroud dextrose agar

40g dextrose or maltose
10g peptone
20g agar
1L sterile dH2O

Twig Media
Promotes sporulation in some species

Make MYEA or MEA (or other media) as above, but add sterile twig section (Oak, Pine, or other.)

 

Category: 
Tags: